WebThe PCR primers were developed from the viral attachment protein encoding gene and have the following sequences: forward primer 5'-d TTTCCTGATTTTTCTTACTAT3' and reverse primer 5'-d AAATTATATACGTAAATAAC 3’ (Ireland and Binepal 1998). The size of the amplicon was 192 bp (Ireland and Binepal, 1998). A Ahmed and Zaher 253 WebJul 30, 1999 · Recently, a PCR assay based on capripoxvirus fusion and attachment protein genes has been described for the detection of capripoxvirus in biopsy and tissue culture and shown to be more sensitive than antigen trapping ELISA (Ireland and Binepal, 1998). A PCR test for SPV detection has also been described by Mangana-Vougiouka et al. (1999).
Lumpy Skin Disease Virus Identification in Different …
WebOct 31, 2009 · Ireland, D.C. and Binepal, Y.S., 1998. Improved detection of capripoxvirus in biopsy samples by PCR. Journal of Virological Methods, 74, 1-7. Article CAS PubMed … WebApr 26, 2024 · For amplification of the 192-bp fragment of LSDV, a forward primer 5′-d TTTCCTGATTTTTCTTACTAT3′ and a reverse primer 5′-d AAATTATATACGTAAATAAC 3′ were used (Ireland and Binepal 1998). PCR reactions were carried out as an initial cycle at 94 °C for 1 min, 50 °C for 30 s, and 72 °C for 1 min, followed by 40 cycles of 94°C for 1 min … reach deklaration
A capripoxvirus detection PCR and antibody ELISA based on the …
WebJul 1, 2001 · More consistent with the current review, for example, following unflattering feedback or assessments in one domain, people might attempt to balance the negative information by focusing on self ... Webprotein encoding gene (Ireland and Binepal 1998). Negative controls comprised of a water control. The PCR was run in a thermocycler (Perkin Elmer GeneAmp PCR System 2400, USA) by using the following thermal cycling conditions: ini-tial denaturation at 95 °C for 1 min, followed by 35 cycles of WebApr 6, 2005 · ing, Hammond & Chand 1994; Carn 1995; Ireland & Binepal 1998; Heine, Stevens, Foord & Boyle 1999). The disease is of economic importance because of … how to spray model cars